non-targeting sgrna Search Results


93
Addgene inc jacob corn
Jacob Corn, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/non-targeting+sgrna/pLG1-puro+Non-targeting+sgRNA+3+(Plasmid+%23109003)/bio_rxiv__2022__11__29__518402-155-50-52
Average 93 stars, based on 1 article reviews
jacob corn - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

93
Addgene inc plg1 non targeting sgrna
Plg1 Non Targeting Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/non-targeting+sgrna/pLG1-puro+Non-targeting+sgRNA+1+(Plasmid+%23109002)/pmc12758218-459-1-3
Average 93 stars, based on 1 article reviews
plg1 non targeting sgrna - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

86
Synthego Inc paper custom non targeting control ntc grna gcacuaccagagcuaacuca synthego nüssing
Paper Custom Non Targeting Control Ntc Grna Gcacuaccagagcuaacuca Synthego Nüssing, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/non-targeting+sgrna/control+non+ntc+sgrna+targeting/pm40769148-750-28-35
Average 86 stars, based on 1 article reviews
paper custom non targeting control ntc grna gcacuaccagagcuaacuca synthego nüssing - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

90
CustomArray Inc nontargeting control sgrnas
The p16INK4A-P2A-mCherry reporter allele recapitulates endogenous transcription of p16INK4A. (A) Schematic diagram of the transcriptional repression of p16INK4A by the CRISPR interference system. The dCas9-KRAB fusion protein was guided to the p16INK4A promoter with 3 individual <t>sgRNAs.</t> (B) qRT-PCR was performed on the p16mCherry/+;dCas9-KRAB cells with 3 different p16INK4A-sgRNAs using primers targeting coding sequences of mCherry and p16INK4A. (C) Flow cytometry analysis was performed on the p16mCherry/+;dCas9-KRAB cells with 2 p16INK4A-sgRNAs. The mean value of the mCherry density in each group was calculated and obtained by 3 replicates. The P value was calculated by a 2-tailed t test. (D) The correlation of transcription reduction in mCherry and p16INK4A in response to dCas9-KRAB–mediated transcription repression (from B) was calculated by Pearson’s correlation test (n = 6). (E) qRT-PCR was performed on the p16mCherry/+ cells with or without the treatment of doxorubicin for 24 h by using specific primers targeting the mRNA sequence of p16INK4A. Three biological replicates were performed. The P value was calculated by a 2-tailed t test. (F) qRT-PCR was performed on the p16mCherry/+ cells with or without the treatment of doxorubicin for 24 h by using specific primers targeting the mRNA sequence of mCherry. Three biological replicates were performed. The P value was calculated by a 2-tailed t test.
Nontargeting Control Sgrnas, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/non-targeting+sgrna/nontargeting+control+sgrnas/pmc06936709-352-33-50
Average 90 stars, based on 1 article reviews
nontargeting control sgrnas - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
GenScript corporation sgrna (small-guide rna) to knocking-out bmal2 as well as non-targeting (nt) sequence
( A ) Oxygen tension (y-axis) as determined by an OxyLite probe in tumors from KPC mice breathing ambient air or pure oxygen (x-axis). Dark blue circles represent averages per tumor and boxplots illustrate their distribution. Light blue circles represent repeat measurments per tumor. ( B ) HIF target genes (orange) controlled directly or indirectly <t>by</t> <t>BMAL2</t> (yellow). Indirect control involves both BMAL2’s negative influence on first (dark blue) or second tier (light blue) RP repressing HIF target genes, and positive influence on first (dark red) and second (light red) tier RP activating HIF target genes. ( C ) Fold change in cell growth relative to cells expressing non-targeting <t>sgRNA</t> in normoxic (21% O2) and hypoxic (1% O2) conditions ( D ) Number of migrated cells for cells expressing non-targeting or BMAL2-directed sgRNA in the indicated oxygen environment. P-values are derived from testing the indicated coefficients from a linear regression model. Significant interaction term suggests synergistic effects of BMAL2 pertubation and hypoxia on cell migration. ( E ) Media pH levels after 72 hours incubation. P-values derived from Welch’s t-test ( F ) Fold change in lactate levels in the indicated oxygen environment expressing either non-targeting or BMAL2-directed sgRNA ( G ) Western Blot for HIF1a, HIF2a,
Sgrna (Small Guide Rna) To Knocking Out Bmal2 As Well As Non Targeting (Nt) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/non-targeting+sgrna/sgrna++small+guide+rna++to+knocking+out+bmal2+as+well+as+non+targeting++nt++sequence/pmc10055246-164-1-16
Average 90 stars, based on 1 article reviews
sgrna (small-guide rna) to knocking-out bmal2 as well as non-targeting (nt) sequence - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
CustomArray Inc sgrnas targeting genes interest
Transcriptome profiling of Ripk4 KO mouse keratinocytes. ( A ) Schematics showing the experimental workflow of RNA sequencing in Ripk4 knock-out keratinocytes and in vivo <t>CRISPR</t> screen of top <t>63</t> <t>downregulated</t> genes. LSL-Pik3ca H1047R ; LSL-Cas9-GFP embryonic (E9.5) mice were transduced with sgNTC (non-targeting control) or sgRipk4. At postnatal day P4, the transduced skin was harvested and processed for RNA sequencing. Differential gene expression analysis revealed 63 significantly downregulated genes in Ripk4 KO compared to sgNTC control mice. These 63 genes were selected to construct a targeted CRISPR library and screened in LSL-Pik3ca H1047R ; LSL-Cas9-GFP mice to identify the Ripk4 downstream genes that themselves act as tumor suppressor genes (image created with biorender.com). ( B ) Heat map showing the differential expression of genes in the sgNTC (control) versus sgRipk4 keratinocytes. ( C ) Gene set enrichment analysis (GSEA) revealed downregulation of the synthesis of very-long-chain fatty acids pathway in Pik3ca H1047R ; Ripk4 KO skin. ( D ) METASCAPE pathway analysis revealed several upregulated and downregulated pathways including epidermis development.
Sgrnas Targeting Genes Interest, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/non-targeting+sgrna/sgrnas+targeting+genes+of+interest++63+downregulated+gene+library++and+nontargeting+sgrnas++2+/pmc09913669-49-21-43
Average 90 stars, based on 1 article reviews
sgrnas targeting genes interest - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

86
Synthego Inc scrambled nontargeting nt sgrnas
Transcriptome profiling of Ripk4 KO mouse keratinocytes. ( A ) Schematics showing the experimental workflow of RNA sequencing in Ripk4 knock-out keratinocytes and in vivo <t>CRISPR</t> screen of top <t>63</t> <t>downregulated</t> genes. LSL-Pik3ca H1047R ; LSL-Cas9-GFP embryonic (E9.5) mice were transduced with sgNTC (non-targeting control) or sgRipk4. At postnatal day P4, the transduced skin was harvested and processed for RNA sequencing. Differential gene expression analysis revealed 63 significantly downregulated genes in Ripk4 KO compared to sgNTC control mice. These 63 genes were selected to construct a targeted CRISPR library and screened in LSL-Pik3ca H1047R ; LSL-Cas9-GFP mice to identify the Ripk4 downstream genes that themselves act as tumor suppressor genes (image created with biorender.com). ( B ) Heat map showing the differential expression of genes in the sgNTC (control) versus sgRipk4 keratinocytes. ( C ) Gene set enrichment analysis (GSEA) revealed downregulation of the synthesis of very-long-chain fatty acids pathway in Pik3ca H1047R ; Ripk4 KO skin. ( D ) METASCAPE pathway analysis revealed several upregulated and downregulated pathways including epidermis development.
Scrambled Nontargeting Nt Sgrnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/non-targeting+sgrna/nontargeting+nt+scrambled+sgrnas/10__1158_slash_2767___9764__crc___23___0528-65-0-3
Average 86 stars, based on 1 article reviews
scrambled nontargeting nt sgrnas - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Synthego Inc nontargeting sgrna
Transcriptome profiling of Ripk4 KO mouse keratinocytes. ( A ) Schematics showing the experimental workflow of RNA sequencing in Ripk4 knock-out keratinocytes and in vivo <t>CRISPR</t> screen of top <t>63</t> <t>downregulated</t> genes. LSL-Pik3ca H1047R ; LSL-Cas9-GFP embryonic (E9.5) mice were transduced with sgNTC (non-targeting control) or sgRipk4. At postnatal day P4, the transduced skin was harvested and processed for RNA sequencing. Differential gene expression analysis revealed 63 significantly downregulated genes in Ripk4 KO compared to sgNTC control mice. These 63 genes were selected to construct a targeted CRISPR library and screened in LSL-Pik3ca H1047R ; LSL-Cas9-GFP mice to identify the Ripk4 downstream genes that themselves act as tumor suppressor genes (image created with biorender.com). ( B ) Heat map showing the differential expression of genes in the sgNTC (control) versus sgRipk4 keratinocytes. ( C ) Gene set enrichment analysis (GSEA) revealed downregulation of the synthesis of very-long-chain fatty acids pathway in Pik3ca H1047R ; Ripk4 KO skin. ( D ) METASCAPE pathway analysis revealed several upregulated and downregulated pathways including epidermis development.
Nontargeting Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/non-targeting+sgrna/nontargeting+sgrna/pmc12804390-35-1-6
Average 86 stars, based on 1 article reviews
nontargeting sgrna - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

Image Search Results


The p16INK4A-P2A-mCherry reporter allele recapitulates endogenous transcription of p16INK4A. (A) Schematic diagram of the transcriptional repression of p16INK4A by the CRISPR interference system. The dCas9-KRAB fusion protein was guided to the p16INK4A promoter with 3 individual sgRNAs. (B) qRT-PCR was performed on the p16mCherry/+;dCas9-KRAB cells with 3 different p16INK4A-sgRNAs using primers targeting coding sequences of mCherry and p16INK4A. (C) Flow cytometry analysis was performed on the p16mCherry/+;dCas9-KRAB cells with 2 p16INK4A-sgRNAs. The mean value of the mCherry density in each group was calculated and obtained by 3 replicates. The P value was calculated by a 2-tailed t test. (D) The correlation of transcription reduction in mCherry and p16INK4A in response to dCas9-KRAB–mediated transcription repression (from B) was calculated by Pearson’s correlation test (n = 6). (E) qRT-PCR was performed on the p16mCherry/+ cells with or without the treatment of doxorubicin for 24 h by using specific primers targeting the mRNA sequence of p16INK4A. Three biological replicates were performed. The P value was calculated by a 2-tailed t test. (F) qRT-PCR was performed on the p16mCherry/+ cells with or without the treatment of doxorubicin for 24 h by using specific primers targeting the mRNA sequence of mCherry. Three biological replicates were performed. The P value was calculated by a 2-tailed t test.

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: A cis -element within the ARF locus mediates repression of p16 INK4A expression via long-range chromatin interactions

doi: 10.1073/pnas.1909720116

Figure Lengend Snippet: The p16INK4A-P2A-mCherry reporter allele recapitulates endogenous transcription of p16INK4A. (A) Schematic diagram of the transcriptional repression of p16INK4A by the CRISPR interference system. The dCas9-KRAB fusion protein was guided to the p16INK4A promoter with 3 individual sgRNAs. (B) qRT-PCR was performed on the p16mCherry/+;dCas9-KRAB cells with 3 different p16INK4A-sgRNAs using primers targeting coding sequences of mCherry and p16INK4A. (C) Flow cytometry analysis was performed on the p16mCherry/+;dCas9-KRAB cells with 2 p16INK4A-sgRNAs. The mean value of the mCherry density in each group was calculated and obtained by 3 replicates. The P value was calculated by a 2-tailed t test. (D) The correlation of transcription reduction in mCherry and p16INK4A in response to dCas9-KRAB–mediated transcription repression (from B) was calculated by Pearson’s correlation test (n = 6). (E) qRT-PCR was performed on the p16mCherry/+ cells with or without the treatment of doxorubicin for 24 h by using specific primers targeting the mRNA sequence of p16INK4A. Three biological replicates were performed. The P value was calculated by a 2-tailed t test. (F) qRT-PCR was performed on the p16mCherry/+ cells with or without the treatment of doxorubicin for 24 h by using specific primers targeting the mRNA sequence of mCherry. Three biological replicates were performed. The P value was calculated by a 2-tailed t test.

Article Snippet: A set of 2,029 sgRNA oligos that target H3K27ac and ATAC-seq positive peaks defined in the TAD containing INK4 / ARF in IMR90, HCT116, and SEM cells as well as an additional 20 nontargeting control sgRNAs with no detectable match to the human genome were designed for array-based oligonucleotide synthesis (CustomArray).

Techniques: CRISPR, Quantitative RT-PCR, Flow Cytometry, Sequencing

Noncoding pooled CRISPR screening identified a distal repressive element of p16INK4A residing within the ARF locus. (A) Schematic diagram of a working model of dCas9-KRAB– and Cas9-mediated noncoding screening. (B) The global correlation of sgRNA distribution in dCas9-KRAB and Cas9 screens in the p16mCherry/+ reporter cell line. (C) The global distribution of all sgRNAs in a selected region of the INK4/ARF locus from 3 screens in the p16mCherry/+ reporter cell line using dCas9-KRAB, Cas9, and no effector control. The red arrow indicates the most enriched sgRNAs in a 42-bp region of the ARF exon1β and intron 1. (D) Two candidate sgRNAs binding to the plus and minus strands of the most enriched 42-bp core DNA sequence near the ARF promoter were designed for validation (ARF-sgRNA-3 and -4). The red arrows indicate the orientation of the sgRNA binding sequences. (E) Western blotting analysis of ARF and p16INK4A in dCas9-KRAB– and Cas9-expressing SEM cells infected with ARF-sgRNA-3, -4, and the nontargeting sgRNA control.

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: A cis -element within the ARF locus mediates repression of p16 INK4A expression via long-range chromatin interactions

doi: 10.1073/pnas.1909720116

Figure Lengend Snippet: Noncoding pooled CRISPR screening identified a distal repressive element of p16INK4A residing within the ARF locus. (A) Schematic diagram of a working model of dCas9-KRAB– and Cas9-mediated noncoding screening. (B) The global correlation of sgRNA distribution in dCas9-KRAB and Cas9 screens in the p16mCherry/+ reporter cell line. (C) The global distribution of all sgRNAs in a selected region of the INK4/ARF locus from 3 screens in the p16mCherry/+ reporter cell line using dCas9-KRAB, Cas9, and no effector control. The red arrow indicates the most enriched sgRNAs in a 42-bp region of the ARF exon1β and intron 1. (D) Two candidate sgRNAs binding to the plus and minus strands of the most enriched 42-bp core DNA sequence near the ARF promoter were designed for validation (ARF-sgRNA-3 and -4). The red arrows indicate the orientation of the sgRNA binding sequences. (E) Western blotting analysis of ARF and p16INK4A in dCas9-KRAB– and Cas9-expressing SEM cells infected with ARF-sgRNA-3, -4, and the nontargeting sgRNA control.

Article Snippet: A set of 2,029 sgRNA oligos that target H3K27ac and ATAC-seq positive peaks defined in the TAD containing INK4 / ARF in IMR90, HCT116, and SEM cells as well as an additional 20 nontargeting control sgRNAs with no detectable match to the human genome were designed for array-based oligonucleotide synthesis (CustomArray).

Techniques: CRISPR, Control, Binding Assay, Sequencing, Biomarker Discovery, Western Blot, Expressing, Infection

Physical interactions between ARF, p16INK4A, and p15INK4B were detected by 3C. (A) Next-generation Capture-C was performed on parental human SEM cells for 2 replicates. Two specific anchor probes (Bait 1 and Bait 2) were designed to hybridize to the H3K27ac peaks that overlap each of the promoters of p16INK4A, ARF, and p15INK4B to capture chromatin interactions with the respective promoters within the INK4/ARF locus. (B) CUT&RUN was performed on p16mCherry/+;dCas9-KRAB cells infected individually with 2 sgRNAs targeting the p16INK4A repressive element adjacent to the ARF promoter and 2 sgRNAs targeting the p16INK4A promoter. A Cas9 antibody that recognizes dCas9 was used for a pull-down assay. ChIP-seq tracks of CTCF and H3K27ac were included to indicate the open chromatin status of the locus.

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: A cis -element within the ARF locus mediates repression of p16 INK4A expression via long-range chromatin interactions

doi: 10.1073/pnas.1909720116

Figure Lengend Snippet: Physical interactions between ARF, p16INK4A, and p15INK4B were detected by 3C. (A) Next-generation Capture-C was performed on parental human SEM cells for 2 replicates. Two specific anchor probes (Bait 1 and Bait 2) were designed to hybridize to the H3K27ac peaks that overlap each of the promoters of p16INK4A, ARF, and p15INK4B to capture chromatin interactions with the respective promoters within the INK4/ARF locus. (B) CUT&RUN was performed on p16mCherry/+;dCas9-KRAB cells infected individually with 2 sgRNAs targeting the p16INK4A repressive element adjacent to the ARF promoter and 2 sgRNAs targeting the p16INK4A promoter. A Cas9 antibody that recognizes dCas9 was used for a pull-down assay. ChIP-seq tracks of CTCF and H3K27ac were included to indicate the open chromatin status of the locus.

Article Snippet: A set of 2,029 sgRNA oligos that target H3K27ac and ATAC-seq positive peaks defined in the TAD containing INK4 / ARF in IMR90, HCT116, and SEM cells as well as an additional 20 nontargeting control sgRNAs with no detectable match to the human genome were designed for array-based oligonucleotide synthesis (CustomArray).

Techniques: Capture-C, Infection, Pull Down Assay, ChIP-sequencing

The ARF/p16INK4A chromatin interaction and transcriptional regulation is functionally detected in NBL cells. (A) qRT-PCR analysis of p16INK4A in the human NBL cell line SK-N-SH infected with lentiviral dCas9-KRAB and ARF-sgRNAs-3 and -4. NT-sgRNA is a nontargeting sgRNA control. Four biological replicates were performed. The P value was calculated by a 2-tailed t test. (B) qRT-PCR analysis of ARF in the human NBL cell SK-N-SH infected with lentiviral dCas9-KRAB and ARF-sgRNAs-3 and -4. Four biological replicates were performed. The P value was calculated by a 2-tailed t test. (C) Western blotting analysis of ARF and p16INK4A in the human NBL cell line SK-N-SH infected with lentiviral dCas9-KRAB and ARF-sgRNA-3 and -4 compared to NT-infected controls. (D) Representative image of SK-N-SH cells stably expressing dCas9-KRAB and ARF-sgRNAs-3, -4, and NT-sgRNA at day 3. (E) Quantification of cell proliferation by cell number count. Two biological replicates were performed. The P value was calculated by a 2-tailed t test. (F) Next-generation Capture-C was performed on SK-N-SH cells stably expressing dCas9-KRAB and ARF-sgRNAs-3, -4, and NT-sgRNA. Anchor probes that hybridized to the p16INK4A promoter were utilized to capture chromatin interactions. Boxes 2 and 3 highlight ARF and p15INK4B promoters which were interacting with the indicated p16INK4A anchor regions. Box 1 indicates a negative control noncoding region. (G) Quantification of interaction frequency between the anchor regions to Boxes 1, 2, and 3. Signal value from the .bw file of Capture-C was normalized by probe signal for each experiment.

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: A cis -element within the ARF locus mediates repression of p16 INK4A expression via long-range chromatin interactions

doi: 10.1073/pnas.1909720116

Figure Lengend Snippet: The ARF/p16INK4A chromatin interaction and transcriptional regulation is functionally detected in NBL cells. (A) qRT-PCR analysis of p16INK4A in the human NBL cell line SK-N-SH infected with lentiviral dCas9-KRAB and ARF-sgRNAs-3 and -4. NT-sgRNA is a nontargeting sgRNA control. Four biological replicates were performed. The P value was calculated by a 2-tailed t test. (B) qRT-PCR analysis of ARF in the human NBL cell SK-N-SH infected with lentiviral dCas9-KRAB and ARF-sgRNAs-3 and -4. Four biological replicates were performed. The P value was calculated by a 2-tailed t test. (C) Western blotting analysis of ARF and p16INK4A in the human NBL cell line SK-N-SH infected with lentiviral dCas9-KRAB and ARF-sgRNA-3 and -4 compared to NT-infected controls. (D) Representative image of SK-N-SH cells stably expressing dCas9-KRAB and ARF-sgRNAs-3, -4, and NT-sgRNA at day 3. (E) Quantification of cell proliferation by cell number count. Two biological replicates were performed. The P value was calculated by a 2-tailed t test. (F) Next-generation Capture-C was performed on SK-N-SH cells stably expressing dCas9-KRAB and ARF-sgRNAs-3, -4, and NT-sgRNA. Anchor probes that hybridized to the p16INK4A promoter were utilized to capture chromatin interactions. Boxes 2 and 3 highlight ARF and p15INK4B promoters which were interacting with the indicated p16INK4A anchor regions. Box 1 indicates a negative control noncoding region. (G) Quantification of interaction frequency between the anchor regions to Boxes 1, 2, and 3. Signal value from the .bw file of Capture-C was normalized by probe signal for each experiment.

Article Snippet: A set of 2,029 sgRNA oligos that target H3K27ac and ATAC-seq positive peaks defined in the TAD containing INK4 / ARF in IMR90, HCT116, and SEM cells as well as an additional 20 nontargeting control sgRNAs with no detectable match to the human genome were designed for array-based oligonucleotide synthesis (CustomArray).

Techniques: Quantitative RT-PCR, Infection, Control, Western Blot, Stable Transfection, Expressing, Capture-C, Negative Control

Loss-of-function CRISPR screening of human transcriptional factors in the p16INK4A reporter cell line. (A) Schematic diagram of a working model of Cas9-mediated CRISPR screening targeting 1,639 human TFs. (B) Gene ranking of looping factors (YY1, first; CTCF, 1,001st) enriched from screening. The enrichment score of 7 sgRNAs against each TF was combined by MAGeCK algorithm. (C, Top) The overall distribution of all sgRNAs from the screening. (C, Bottom) The Log2[Fold Change (top10/bottom10)] ratio for all sgRNAs targeting CTCF, YY1, and the top 10 negative regulators from D and NT sgRNAs were overlaid on a gray gradient depicting the overall distribution. NT: 100 gRNAs; TF: 7 sgRNAs/each. (D) Gene ranking of top 10 negative candidate regulators enriched from screening analysis by MAGeCK algorithm. (E) Immunoblotting of YY1 in p16mCherry/+;Cas9 cells targeted individually with 2 sgRNAs against the coding sequence of human YY1. GAPDH was probed as a loading control. (F) The p16mCherry/+;Cas9 cells were targeted with Cas9 and 2 sgRNAs identified from TF screening targeting the coding region of human YY1. Flow cytometry analysis of mCherry reporter activity was subsequently conducted in YY1-targeted cells compared with NT control. (G) YY1-binding motif prediction by JASPAR algorithm. (H) CUT&RUN of YY1 was conducted in p16mCherry/+;dCas9-KRAB cells infected with ARF-sgRNA-4 and NT-sgRNA for 2 replicates. Tracks were shown at the viewpoint of the INK4/ARF locus. (I) CUT&RUN of ZNF217 was conducted in p16mCherry/+;dCas9-KRAB cells infected with ARF-sgRNA-4 and NT-sgRNA. Tracks were shown at the viewpoint of the INK4/ARF locus. (J) CUT&RUN of ZNF217 was conducted in p16mCherry/+;dCas9-KRAB cells infected with ARF-sgRNA-4 and NT-sgRNA. Tracks of ZNF217 were shown for viewpoint at a randomly chosen locus.

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: A cis -element within the ARF locus mediates repression of p16 INK4A expression via long-range chromatin interactions

doi: 10.1073/pnas.1909720116

Figure Lengend Snippet: Loss-of-function CRISPR screening of human transcriptional factors in the p16INK4A reporter cell line. (A) Schematic diagram of a working model of Cas9-mediated CRISPR screening targeting 1,639 human TFs. (B) Gene ranking of looping factors (YY1, first; CTCF, 1,001st) enriched from screening. The enrichment score of 7 sgRNAs against each TF was combined by MAGeCK algorithm. (C, Top) The overall distribution of all sgRNAs from the screening. (C, Bottom) The Log2[Fold Change (top10/bottom10)] ratio for all sgRNAs targeting CTCF, YY1, and the top 10 negative regulators from D and NT sgRNAs were overlaid on a gray gradient depicting the overall distribution. NT: 100 gRNAs; TF: 7 sgRNAs/each. (D) Gene ranking of top 10 negative candidate regulators enriched from screening analysis by MAGeCK algorithm. (E) Immunoblotting of YY1 in p16mCherry/+;Cas9 cells targeted individually with 2 sgRNAs against the coding sequence of human YY1. GAPDH was probed as a loading control. (F) The p16mCherry/+;Cas9 cells were targeted with Cas9 and 2 sgRNAs identified from TF screening targeting the coding region of human YY1. Flow cytometry analysis of mCherry reporter activity was subsequently conducted in YY1-targeted cells compared with NT control. (G) YY1-binding motif prediction by JASPAR algorithm. (H) CUT&RUN of YY1 was conducted in p16mCherry/+;dCas9-KRAB cells infected with ARF-sgRNA-4 and NT-sgRNA for 2 replicates. Tracks were shown at the viewpoint of the INK4/ARF locus. (I) CUT&RUN of ZNF217 was conducted in p16mCherry/+;dCas9-KRAB cells infected with ARF-sgRNA-4 and NT-sgRNA. Tracks were shown at the viewpoint of the INK4/ARF locus. (J) CUT&RUN of ZNF217 was conducted in p16mCherry/+;dCas9-KRAB cells infected with ARF-sgRNA-4 and NT-sgRNA. Tracks of ZNF217 were shown for viewpoint at a randomly chosen locus.

Article Snippet: A set of 2,029 sgRNA oligos that target H3K27ac and ATAC-seq positive peaks defined in the TAD containing INK4 / ARF in IMR90, HCT116, and SEM cells as well as an additional 20 nontargeting control sgRNAs with no detectable match to the human genome were designed for array-based oligonucleotide synthesis (CustomArray).

Techniques: CRISPR, Western Blot, Sequencing, Control, Flow Cytometry, Activity Assay, Binding Assay, Infection

( A ) Oxygen tension (y-axis) as determined by an OxyLite probe in tumors from KPC mice breathing ambient air or pure oxygen (x-axis). Dark blue circles represent averages per tumor and boxplots illustrate their distribution. Light blue circles represent repeat measurments per tumor. ( B ) HIF target genes (orange) controlled directly or indirectly by BMAL2 (yellow). Indirect control involves both BMAL2’s negative influence on first (dark blue) or second tier (light blue) RP repressing HIF target genes, and positive influence on first (dark red) and second (light red) tier RP activating HIF target genes. ( C ) Fold change in cell growth relative to cells expressing non-targeting sgRNA in normoxic (21% O2) and hypoxic (1% O2) conditions ( D ) Number of migrated cells for cells expressing non-targeting or BMAL2-directed sgRNA in the indicated oxygen environment. P-values are derived from testing the indicated coefficients from a linear regression model. Significant interaction term suggests synergistic effects of BMAL2 pertubation and hypoxia on cell migration. ( E ) Media pH levels after 72 hours incubation. P-values derived from Welch’s t-test ( F ) Fold change in lactate levels in the indicated oxygen environment expressing either non-targeting or BMAL2-directed sgRNA ( G ) Western Blot for HIF1a, HIF2a,

Journal: bioRxiv

Article Title: Ras-dependent activation of BMAL2 regulates hypoxic metabolism in pancreatic cancer

doi: 10.1101/2023.03.19.533333

Figure Lengend Snippet: ( A ) Oxygen tension (y-axis) as determined by an OxyLite probe in tumors from KPC mice breathing ambient air or pure oxygen (x-axis). Dark blue circles represent averages per tumor and boxplots illustrate their distribution. Light blue circles represent repeat measurments per tumor. ( B ) HIF target genes (orange) controlled directly or indirectly by BMAL2 (yellow). Indirect control involves both BMAL2’s negative influence on first (dark blue) or second tier (light blue) RP repressing HIF target genes, and positive influence on first (dark red) and second (light red) tier RP activating HIF target genes. ( C ) Fold change in cell growth relative to cells expressing non-targeting sgRNA in normoxic (21% O2) and hypoxic (1% O2) conditions ( D ) Number of migrated cells for cells expressing non-targeting or BMAL2-directed sgRNA in the indicated oxygen environment. P-values are derived from testing the indicated coefficients from a linear regression model. Significant interaction term suggests synergistic effects of BMAL2 pertubation and hypoxia on cell migration. ( E ) Media pH levels after 72 hours incubation. P-values derived from Welch’s t-test ( F ) Fold change in lactate levels in the indicated oxygen environment expressing either non-targeting or BMAL2-directed sgRNA ( G ) Western Blot for HIF1a, HIF2a,

Article Snippet: The sgRNA (small-guide RNA) to knocking-out BMAL2 as well as non-targeting (NT) sequence were purchased from GenScript (Piscataway, NJ) using pLentiGuide-Puro vector as a backbone.

Techniques: Control, Expressing, Derivative Assay, Migration, Incubation, Western Blot

Transcriptome profiling of Ripk4 KO mouse keratinocytes. ( A ) Schematics showing the experimental workflow of RNA sequencing in Ripk4 knock-out keratinocytes and in vivo CRISPR screen of top 63 downregulated genes. LSL-Pik3ca H1047R ; LSL-Cas9-GFP embryonic (E9.5) mice were transduced with sgNTC (non-targeting control) or sgRipk4. At postnatal day P4, the transduced skin was harvested and processed for RNA sequencing. Differential gene expression analysis revealed 63 significantly downregulated genes in Ripk4 KO compared to sgNTC control mice. These 63 genes were selected to construct a targeted CRISPR library and screened in LSL-Pik3ca H1047R ; LSL-Cas9-GFP mice to identify the Ripk4 downstream genes that themselves act as tumor suppressor genes (image created with biorender.com). ( B ) Heat map showing the differential expression of genes in the sgNTC (control) versus sgRipk4 keratinocytes. ( C ) Gene set enrichment analysis (GSEA) revealed downregulation of the synthesis of very-long-chain fatty acids pathway in Pik3ca H1047R ; Ripk4 KO skin. ( D ) METASCAPE pathway analysis revealed several upregulated and downregulated pathways including epidermis development.

Journal: Cancers

Article Title: The NOTCH-RIPK4-IRF6-ELOVL4 Axis Suppresses Squamous Cell Carcinoma

doi: 10.3390/cancers15030737

Figure Lengend Snippet: Transcriptome profiling of Ripk4 KO mouse keratinocytes. ( A ) Schematics showing the experimental workflow of RNA sequencing in Ripk4 knock-out keratinocytes and in vivo CRISPR screen of top 63 downregulated genes. LSL-Pik3ca H1047R ; LSL-Cas9-GFP embryonic (E9.5) mice were transduced with sgNTC (non-targeting control) or sgRipk4. At postnatal day P4, the transduced skin was harvested and processed for RNA sequencing. Differential gene expression analysis revealed 63 significantly downregulated genes in Ripk4 KO compared to sgNTC control mice. These 63 genes were selected to construct a targeted CRISPR library and screened in LSL-Pik3ca H1047R ; LSL-Cas9-GFP mice to identify the Ripk4 downstream genes that themselves act as tumor suppressor genes (image created with biorender.com). ( B ) Heat map showing the differential expression of genes in the sgNTC (control) versus sgRipk4 keratinocytes. ( C ) Gene set enrichment analysis (GSEA) revealed downregulation of the synthesis of very-long-chain fatty acids pathway in Pik3ca H1047R ; Ripk4 KO skin. ( D ) METASCAPE pathway analysis revealed several upregulated and downregulated pathways including epidermis development.

Article Snippet: Plasmid pDS1 (Addgene #158032) expressing U6-sgRNA stuffer-tracr cassette and hPGK-driven Cre recombinase (Cre) (19) was used in all the experiments involving CRISPR methodology. sgRNAs targeting genes of interest (63 downregulated gene library) and non-targeting sgRNAs (2), were ordered as a pooled oligo chip (CustomArray Inc., Redmond, WA, USA) and cloned into pDS1 using BsmBI restriction sites.

Techniques: RNA Sequencing Assay, Knock-Out, In Vivo, CRISPR, Transduction, Expressing, Construct

Elovl4 is a tumor suppressor downstream of Ripk4. ( A ) Representative image of tumors in an LSL- Pik3ca H1047R ; LSL-Cas9-GFP mouse transduced with LV carrying Cre recombinase and sgRNAs targeting the genes downregulated in Ripk4-deficient keratinocytes. ( B ) Tumor-free survival for LSL-Pik3ca H1047R ; LSL-Cas9-GFP mouse transduced with downregulated genes library ( n ≥ 8 per group; p < 0.0001, log-rank test). ( C ) Pie chart showing the genes that have their corresponding sgRNAs enriched in the tumors collected from mice transduced with the CRISPR gene library targeting downregulated Ripk4 target genes. ( D ) Real-time PCR results showing relative expression of indicated genes in mouse keratinocytes carrying CRISPR/Cas9-mediated ablation of Ripk4 when compared to non-targeting control. Data are shown as means ± SEM ( n = 3). * Denotes p -value < 0.05. (E) Tumor-free survival for tumor-prone Pik3ca H1047R ;Cas9 mice transduced with an independent sgRNA against Elovl4. sgNTC served as a control ( n ≥ 5 per group; p < 0.0001, log-rank test). (F) Representative images of tumors in the head and neck region of Pik3ca H1047R ; Cas9 mice transduced with sgElovl4 LV-Cre.

Journal: Cancers

Article Title: The NOTCH-RIPK4-IRF6-ELOVL4 Axis Suppresses Squamous Cell Carcinoma

doi: 10.3390/cancers15030737

Figure Lengend Snippet: Elovl4 is a tumor suppressor downstream of Ripk4. ( A ) Representative image of tumors in an LSL- Pik3ca H1047R ; LSL-Cas9-GFP mouse transduced with LV carrying Cre recombinase and sgRNAs targeting the genes downregulated in Ripk4-deficient keratinocytes. ( B ) Tumor-free survival for LSL-Pik3ca H1047R ; LSL-Cas9-GFP mouse transduced with downregulated genes library ( n ≥ 8 per group; p < 0.0001, log-rank test). ( C ) Pie chart showing the genes that have their corresponding sgRNAs enriched in the tumors collected from mice transduced with the CRISPR gene library targeting downregulated Ripk4 target genes. ( D ) Real-time PCR results showing relative expression of indicated genes in mouse keratinocytes carrying CRISPR/Cas9-mediated ablation of Ripk4 when compared to non-targeting control. Data are shown as means ± SEM ( n = 3). * Denotes p -value < 0.05. (E) Tumor-free survival for tumor-prone Pik3ca H1047R ;Cas9 mice transduced with an independent sgRNA against Elovl4. sgNTC served as a control ( n ≥ 5 per group; p < 0.0001, log-rank test). (F) Representative images of tumors in the head and neck region of Pik3ca H1047R ; Cas9 mice transduced with sgElovl4 LV-Cre.

Article Snippet: Plasmid pDS1 (Addgene #158032) expressing U6-sgRNA stuffer-tracr cassette and hPGK-driven Cre recombinase (Cre) (19) was used in all the experiments involving CRISPR methodology. sgRNAs targeting genes of interest (63 downregulated gene library) and non-targeting sgRNAs (2), were ordered as a pooled oligo chip (CustomArray Inc., Redmond, WA, USA) and cloned into pDS1 using BsmBI restriction sites.

Techniques: Transduction, CRISPR, Real-time Polymerase Chain Reaction, Expressing